Serving Australia and NZ
1300 543 373

COVID-19 Products



The biomedical community is working urgently to develop novel reagents specific for COVID-19 (2019-nCov, SARS-CoV-2).

Please find below our latest list of reagents for Australian and New Zealand researchers.

Request ETA

Last updated 2/04/20
count: 230

Created by Sarah Fardy

Coronavirus Products from Jomar Life Research
Human ACE2 products also available, but not listed here
Top Selling
Supplier Cat # Size Name Details





20 tests

Coronavirus (SARS-CoV-2) IgM Test Kit (Colloidal Gold)

Coronavirus (SARS-CoV-2) IgM Finger Prick Test Kit (Colloidal Gold)

Coronavirus IgG Test Kit (Colloidal Gold)

Coronavirus (SARS-CoV-2) IgG Finger PrickTest Kit (Colloidal Gold)

20 strips. Suitable for the qualitative detection of coronavirus N-Protein IgM / IgG antibodies in human serum, plasma, or peripheral blood. RayBiotech offers new tools for fighting against Coronavirus for in vitro diagnostic use, following guidance from the FDA for Emergency Use Authorizations of tests submitted for approval on March 16, 2020. These tests have not been reviewed by the FDA and results from antibody testing should not be used as the sole basis to diagnose or exclude SARS-CoV-2 infection or to inform infection status.
Sino Biological 40592-V05H 100 μg SARS-CoV-2/2019-nCoV Spike/RBD Protein (RBD, mFc Tag) Human (bind ACE2)
Sino Biological 40592-V08B 100 μg SARS-CoV-2/2019-nCoV Spike/RBD Protein (RBD, His Tag)

Expressed in Baculovirus-Insect Cells
(bind ACE2)

Sino Biological 40592-V02H 100 μg SARS-CoV-2/2019-nCoV Spike/RBD Protein (RBD, Fc Tag) Human (bind ACE2)
Sino Biological 40592-V31H 100 μg SARS-CoV-2/2019-nCoV Spike/RBD Protein (RBD, rabbitFc Tag) Human (bind ACE2)
Biotium  31000 5 x 1 mL EvaGreen® Dye, 20X in Water LAMP PCR COVID-19 with EvaGreen. A Single and Two-Stage, Closed-Tube, Molecular Test for the 2019 Novel
Coronavirus (COVID-19) at Home, Clinic, and Points of Entry. (Published:

Biotium 31077 5 x 1 mL EvaGreen® Plus Dye, 20X in Water EvaGreen® Plus Dye has an improved signal-to-noise compared to original EvaGreen® dye, for higher sensitivity in DNA amplification applications
COVID-19 Related Screening Libraries


Cat # Size Name Details


Pre-dissolved In DMSO or Water

Offered in 96 or 384 well plate format

Antiviral Compound Library A unique collection of 348 antiviral compounds used for exploring novel antiviral drug.


Pre-dissolved In DMSO or Water

Offered in 96 or 384 well plate format

Nucleoside Analogue Library A unique collection of 135 nucleoside analogues used for high throughput screening(HTS) and high content screening(HCS).

Acro Biosystems




2019-nCoV Inhibitor screening Kit

Materials Provided
A010-214 2019-nCoV S protein RBD
A011-214 Biotinylated Human ACE2
A003-214 Streptavidin-HRP

COVID-19 Related Inhibitors


Cat# Size Name Details


S4430 As requested 
Hydroxychloroquine Sulfate Hydroxychloroquine Sulfate is an antimalarial agent used for the treatment of systemic lupus erythematosus, rheumatoid arthritis and other autoimmune, inflammatory and dermatologic conditions. Also acts as an inhibitor of autophagy and toll-like receptor (TLR) 7/9.
Selleck S2853 As requested Carfilzomib (PR-171) Carfilzomib (PR-171) is an irreversible proteasome inhibitor with IC50 of <5 nM in ANBL-6 cells, displayed preferential in vitro inhibitory potency against the ChT-L activity in the β5 subunit, but little or no effect on the PGPH and T-L activities.
Selleck S7975 As requested Favipiravir (T-705) Favipiravir (T-705) is a potent and selective RNA-dependent RNA polymerase inhibitor, used to treat influenza virus infections.
Selleck S1835 As requested Azithromycin Azithromycin is an antibiotic by inhibiting protein synthesis, used for the treatment of bacterial infections.
Selleck S1620 As requested Darunavir Ethanolate Darunavir Ethanolate (DRV) is a nonpeptidic HIV protease inhibitor, used to treat HIV infection.
Selleck S3035 As requested Daunorubicin HCl Daunorubicin HCl inhibits both DNA and RNA synthesis and inhibits DNA synthesis with Ki of 0.02 μM in a cell-free assay.
Selleck S4157 As requested Chloroquine diphosphate Chloroquine diphosphate is a 4-aminoquinoline anti-malarial and anti-rheumatoid agent, also acting as an ATM activator.
Selleck S8932 As requested Remdesivir (GS-5734) Remdesivir,a monophosphoramidate prodrug of an adenosine analog, is an investigational broad-spectrum antiviral agent with in vitro activity against multiple RNA viruses, including Ebola and CoV.
Selleck S5911 As requested Bictegravir Bictegravir is a novel, potent, once-daily, unboosted inhibitor of HIV-1 integrase.
Selleck S1759 As requested Pitavastatin Calcium Pitavastatin calcium, a novel member of the medication class of statins, is a calcium salt formulation of pitavastatin which is a highly effective HMG-CoA reductase inhibitor.
Selleck S1380 As requested Lopinavir Lopinavir is a potent HIV protease inhibitor with Ki of 1.3 pM in a cell-free assay.
Selleck S2485 As requested Mitoxantrone 2HCl Mitoxantrone is a type II topoisomerase inhibitor with IC50 of 2.0 μM, 0.42 mM for HepG2 and MCF-7/wt cells, respectively.
Selleck S4282 As requested Nelfinavir Mesylate Nelfinavir Mesylate is a potent HIV protease inhibitor with Ki of 2 nM.
Selleck S1185 As requested Ritonavir Ritonavir is a Cytochrome P450 3A and Protease Inhibitor; Also inhibits Cytochrome P450 2D6P-Glycoprotein and induces Cytochrome P450 2C19Cytochrome P450 1A2Cytochrome P450 2C9Cytochrome P450 2B6 and UDP Glucuronosyltransferases.
Selleck S5072 As requested Rosuvastatin Rosuvastatin is an inhibitor of HMG-CoA reductase, an enzyme that catalyzes the rate-limiting step in cholesterol biosynthesis, with Ki value (inhibition constant) of approximately 0.1 nM.
Selleck S5250 As requested Darunavir Darunavir is a nonpeptidic HIV protease inhibitor, used to treat HIV infection.
Selleck S7579 As requested Ledipasvir (GS5885) Ledipasvir (GS5885) is a HCV NS5A polymerase inhibitor, used for the treatment of hepatitis C virus infection.
Selleck S1538 As requested Telaprevir (VX-950) Telaprevir (VX-950) is an HCV NS3-4A serine protease inhibitor with IC50 of 0.35 μM.
Selleck S1183 As requested Danoprevir (ITMN-191) Danoprevir(ITMN-191) is a peptidomimetic inhibitor of the NS3/4A protease of hepatitis C virus (HCV) with IC50 of 0.2-3.5 nM, inhibition effect for HCV genotypes 1A/1B/4/5/6 is ~10-fold higher than 2B/3A. Phase 2.
Selleck S2169 As requested Rosuvastatin Calcium Rosuvastatin Calcium is a competitive inhibitor of HMG-CoA reductase with IC50 of 11 nM in a cell-free assay.
Selleck S3079 As requested Atovaquone Atovaquone is a medication used to treat or prevent for pneumocystis pneumonia, toxoplasmosis, malaria, and babesia.
Selleck S1691 As requested Praziquantel Praziquantel is an anthelmintic effective against flatworms.
Selleck S3733 As requested Boceprevir Boceprevir is an oral, direct acting hepatitis C virus (HCV) protease inhibitor with Ki value of 14 nM for NS3. It is used in combination with other antiviral agents in the treatment of chronic hepatitis C, genotype 1
Selleck S3724 As requested Velpatasvir Velpatasvir is a second-generation NS5A inhibitor that inhibits hepatitis C viral replication through acting on the crucial "membranous web" that facilitates RNA replication.
Selleck S2071 As requested Prulifloxacin (NM441) Prulifloxacin, the prodrug of ulifloxacin, is a broad-spectrum oral fluoroquinolone antibacterial agent.
Selleck S9567 As requested Indinavir Sulfate Indinavir sulfate is a specific and potent inhibitor of HIV-1 protease and is widely used in the treatment of AIDS.
Selleck S2079 As requested Moexipril HCl Moexipril HCl is a potent orally active nonsulfhydryl angiotensin converting enzyme (ACE) inhibitor, used for the treatment of hypertension and congestive heart failure
Selleck S3037 As requested Bepotastine Besilate Bepotastine is a non-sedating, selective antagonist of histamine 1 (H1) receptor with pIC50 of 5.7.
Selleck S5940 As requested Bepotastine Bepotastine is a non-sedating, selective antagonist of the histamine 1 (H1) receptor that is indicated in allergic rhinitis, urticaria, and pruritus associated with skin disease.
Recombinant Proteins
Supplier Cat # Size Name Details
Prospec SARS-003 -100µg 100 µg Recombinant Coronavirus NL63 (Nucleoprotein) E. coli expressed
Prospec SARS-003 -0.5mg 0.5mg Recombinant Coronavirus NL63 (Nucleoprotein) E. coli expressed
Prospec SARS-003 -1mg 1mg Recombinant Coronavirus NL63 (Nucleoprotein) E. coli expressed
Prospec SARS-001 -100µg 100µg Recombinant Coronavirus 229E (Nucleoprotein) E. coli expressed
The protein is fused to a 6xHis tag at C-terminal 
Prospec SARS-001 -0.5mg 0.5mg Recombinant Coronavirus 229E (Nucleoprotein) E. coli expressed
The protein is fused to a 6xHis tag at C-terminal 
Prospec SARS-001 -1mg 1mg Recombinant Coronavirus 229E (Nucleoprotein) E. coli expressed
The protein is fused to a 6xHis tag at C-terminal 
BioVision P1507-10 10 μg Recombinant Coronavirus Nucleoprotein (CoV-NP-NL63) E. coli expressed
BioVision P1507-50 50 μg Recombinant Coronavirus Nucleoprotein (CoV-NP-NL63) E. coli expressed
BioVision P1506-50 10 μg Recombinant Coronavirus Nucleoprotein (CoV-NP-229E)
(His Tag)
E. coli expressed
BioVision P1506-10 50 μg Recombinant Coronavirus Nucleoprotein (CoV-NP-229E)
(His Tag)
E. coli expressed
SinoBiological 40588-V08B 100 μg SARS-CoV-2 (2019-nCoV) Nucleocapsid Protein (His tag) Expressed in Baculovirus-Insect Cells
SinoBiological 40605-V08B 100 μg HCoV-229E CoV spike (S1+S2) Cys16-Trp1115 (His Tag) Expressed in Baculovirus-Insect Cells
SinoBiological 40601-V08H 100 μg HCoV-229E CoV spike (S1) Cys16-Asn536 (His Tag)

Expressed in HEK293 Cells

SinoBiological 40604-V08B 100 μg HCoV-NL63 CoV spike (S1+S2 ECD) (His Tag) Expressed in Baculovirus-Insect Cells
SinoBiological 40600-V08H 100 μg HCoV-NL63 CoV spike (S1) (His Tag)

Expressed in HEK293 Cells


SinoBiological 40607-V08B 100 μg HCoV-OC43 CoV spike (S1+S2 ECD) (His Tag)

Expressed in Baculovirus-Insect Cells


SinoBiological 40603-V08H 100 μg HCoV-OC43 CoV Hemagglutinin esterase Protein (His Tag)

Expressed in HEK293 Cells


SinoBiological 40602-V08H 100 μg Human coronavirus HKU1 (isolate N5) (HCoV-HKU1) Spike Protein (S1 Subunit, His Tag)

Expressed in HEK293 Cells


SinoBiological 40021-V08H 100 μg Human coronavirus HKU1 (isolate N1) (HCoV-HKU1) Spike/S1 Protein Met (S1 Subunit, His Tag) 

Expressed in HEK293 Cells

1-Arg 760

SinoBiological 40606-V08B 100 μg Human coronavirus HKU1 (isolate N5) (HCoV-HKU1) Spike Protein (S1+S2 ECD, His Tag)

Expressed in Baculovirus-Insect Cells


SinoBiological Custom Req. Avail.   (CoV-NP-NL63) Nucleocapsid Protein (His tag) Expressed in Baculovirus-Insect Cells
SinoBiological Custom Req. Avail.   (CoV-NP 229E) Nucleocapsid Protein (His tag) Expressed in Baculovirus-Insect Cells
SinoBiological Custom Req. Avail.   (CoV-NP HKU1) Nucleocapsid Protein (His tag) Expressed in Baculovirus-Insect Cells
SinoBiological Custom Req. Avail.   (CoV-NP OC43) Nucleocapsid Protein (His tag) Expressed in Baculovirus-Insect Cells
Sino Biological 40592-V05H 100 μg SARS-CoV-2/2019-nCoV Spike/RBD Protein (RBD, mFc Tag)

Expressed in HEK293 Cells

(bind ACE2)

Sino Biological 40592-V08B 100 μg SARS-CoV-2/2019-nCoV Spike/RBD Protein (RBD, His Tag)

Expressed in Baculovirus-Insect Cells

(bind ACE2)

Sino Biological 40592-V02H 100 μg SARS-CoV-2/2019-nCoV Spike/RBD Protein (RBD, Fc Tag)

Expressed in HEK293 Cells


(bind ACE2)

Sino Biological 40592-V31H 100 μg SARS-CoV-2/2019-nCoV Spike/RBD Protein (RBD, rabbitFc Tag)

Expressed in HEK293 Cells


 (bind ACE2)

Sino Biological 40591-V08B1 100 μg SARS-CoV-2 (2019-nCoV) S1 Subunit Protein (His tag)

Expressed in Baculovirus-Insect Cells


Sino Biological 40591-V02H 100 μg SARS-CoV-2 (2019-nCoV) S1 Subunit Protein (Fc Tag)

Expressed in HEK293 Cells


(bind ACE2)

Sino Biological 40591-V08H 100 μg SARS-CoV-2 (2019-nCoV) S1 Subunit Protein (His Tag)

Expressed in HEK293 Cells


(bind ACE2)

Sino Biological 40591-V05H1 100 μg SARS-CoV-2 (2019-nCoV) S1 Subunit Protein (mFc Tag)

Expressed in HEK293 Cells


(bind ACE2)

Sino Biological 40590-V08B 100 μg SARS-CoV-2 (2019-nCoV) S2 Protein (S2 ECD, His tag)

Expressed in Baculovirus-Insect Cells


Sino Biological 40589-V08B1 100 μg SARS-CoV-2 (2019-nCoV) S1+S2 ECD Protein (His Tag)

Expressed in Baculovirus-Insect Cells


(bind ACE2)

RayBiotech 230-01101 100 µg, 500 µg, 1000 µg Recombinant SARS-CoV-2 Spike Protein, S1 Subunit (His Tag)

E. coli expressed

Val16 - Gln690

Protein contains N-terminal His-tag

RayBiotech 230-01102 100 µg, 500 µg, 1000 µg

Recombinant SARS-CoV-2 Spike Protein, S1 Subunit, Host Cell Receptor Binding Domain (RBD) (His Tag)

E. coli expressed

Arg319 - Phe541

Protein contains N-terminal His-tag

RayBiotech 230-01103 100 µg, 500 µg, 1000 µg Recombinant SARS-CoV-2 Spike Protein, S2 Subunit (His Tag)

E. coli expressed

Met697 - Pro1213

Protein contains N-terminal His-tag

RayBiotech 230-01104 100 µg, 500 µg, 1000 µg Recombinant SARS-CoV-2 Nucleocapsid Protein (His Tag)

E. coli expressed

Met1 - Ala419

Protein contains N-terminal His-tag

RayBiotech 230-20405-200 200 µL Recombinant SARS-CoV-2 S1 Subunit Protein (RBD) (Fc Tag)

HEK293 overexpression cell culture medium (unpurified)


Protein contains C-terminal Fc-tag

RayBiotech 230-20406-200 200 µL Recombinant SARS-CoV-2 S1 Subunit Protein (RBD) (His Tag)

HEK293 overexpression cell culture medium (unpurified)


Protein contains C-terminal His-tag

RayBiotech 230-20407-200 200 µL Recombinant SARS-CoV-2 S1 Subunit Protein (His Tag)

HEK293 overexpression cell culture medium (unpurified)

Val16 - Gln690

Protein contains C-terminal His-tag

RayBiotech 230-20408-200 200 µL

Recombinant SARS-CoV-2 S2 Subunit Protein (His Tag)

HEK293 overexpression cell culture medium (unpurified)

Met697 - Pro1213

Protein contains C-terminal His-tag

RayBiotech 230-20409-200 200 µL Recombinant SARS-CoV-2 Nucleocapsid Protein (His Tag) 

HEK293 overexpression cell culture medium (unpurified)

Met1 - Ala419

Protein contains C-terminal His-tag

RayBiotech 230-30162 100 µg, 500 µg, 1000 µg Recombinant SARS-CoV-2, S1 Subunit Protein (RBD) (Fc Tag)

>95% Purity

Expressed in HEK293 Cells


Protein contains C-terminal Fc-tag

RayBiotech 230-30164 100 µg, 500 µg, 1000 µg Recombinant SARS-CoV-2 Nucleocapsid Protein (His Tag)

>90% Purity

Expressed in HEK293 Cells


Protein contains C-terminal His-tag

ACROBiosystems SPN-C52H4 100 µg, 1mg 2019-nCoV S protein Full Length (R683A, R685A), His Tag S protein (HEK293)
ACROBiosystems S1N-C52H3 100 µg, 1mg 2019-nCoV S1 protein, His Tag S1 protein (HEK293)
ACROBiosystems S1N-C82E8 25 µg, 200 µg Biotinylated 2019-nCoV S1 protein, His,Avitag™ S1 protein (HEK293)
ACROBiosystems S1N-C52H6 Pre-order 2019-nCoV S1 protein trimer, His Tag S1 protein (HEK293)
ACROBiosystems SPD-C82E9 Pre-order Biotinylated 2019-nCoV S protein RBD, His,Avitag™ S protein RBD (HEK293)
ACROBiosystems SPD-C5255 Pre-order 2019-nCoV S protein RBD, Fc Tag S protein RBD (HEK293)
ACROBiosystems S2N-C52H3 Pre-order 2019-nCoV S2 protein, His Tag S2 protein (HEK293)
ACROBiosystems 3CO-C51H5 Pre-order 2019-nCoV 3CL-Mpro Protein, His Tag 3CL-Mpro (E.coli)
ACROBiosystems NUN-C51H9 Pre-order 2019-nCoV Nucleocapsid protein, His Tag Nucleocapsid protein (E.coli)
ACROBiosystems ENN-C5128 Pre-order 2019-nCoV Envelope protein, His Tag Envelope protein (E.coli)
US Biological 532230 100 μg Coronavirus (COVID-19) Spike 2, Strain Wuhan-Hu-1, Recombinant, aa685-1211, Fc-Tag Recombinant, Mammalian Cell Expression System (>80% pure)
US Biological 532228 100 μg Coronavirus (COVID-19) Nucleoprotein, Strain Wuhan-Hu-1, Recombinant, aa2-419, His-Tag Recombinant, E. coli (>95% pure)
USBiological 532229 100 μg Coronavirus (COVID-19) Spike 1, Strain Wuhan-Hu-1, Recombinant, Fc-Tag, aa1-674 Recombinant, Mammalian Cell Expression System (>95% pure)
GenScript Z03488 100 ug, 1mg SARS-CoV-2 Nucleocapsid protein Expressed in E. coli
GenScript Z03480 100 ug, 1mg SARS-CoV-2 Nucleocapsid protein (His Tag) Expressed in E. coli
GenScript Z03481 100 ug, 1mg SARS-CoV-2 Spike protein (ECD, His & Flag Tag) Expressed in Sf9 insect cells 
GenScript Z03479 100 ug, 1mg SARS-CoV-2 Spike protein (RBD, His Tag) Expressed in Sf9 insect cells 
GenScript Z03483 100 ug, 1mg SARS-CoV-2 Spike protein (RBD, His Tag) Expressed in human cells 
GenScript Z03501 100 ug, 1mg SARS-CoV-2 Spike protein (S1) Expressed in human cells 
GenScript Z03497 100 ug, 1mg SARS-CoV-2 Nucleocapsid S-RBD Fusion protein Expressed in E.coli
GenScript Z03498 100 ug, 1mg SARS-CoV-2 Nucleocapsid S-RBD Fusion protein Expressed in human cells 
GenScript Z03484 100 ug, 1mg ACE-2 Fc Chimera, Human Expressed in human cells 
GenScript Z03485 100µg, 1mg SAR-CoV-2 S1 protein (His Tag) Expressed in human cells 
GenScript Z03487 100µg, 1mg SAR-CoV-2 S2 protein (ECD, His Tag) Expressed in human cells 
GenScript Z03490 100µg, 1mg SAR-CoV-2 S protein (RBD, Fc Tag) Expressed in Sf9 insect cells 
GenScript Z03491 100µg, 1mg SAR-CoV-2 S protein (RBD, Fc Tag) Expressed in human cells 
GenScript Z03492 100µg, 1mg SAR-CoV-2 S1 protein Expressed in E.coli
GenScript Z03493 100µg, 1mg SAR-CoV-2 S1 protein (Fc Tag) Expressed in human cells 
GenScript Z03495 100µg, 1mg SAR-CoV-2 S2 protein (ECD, Fc Tag) Expressed in human cells 
GenScript Z03496 100µg, 1mg SAR-CoV-2 S protein (His Tag) Expressed in Sf9 insect cells 
Supplier Cat # Size Name Details
Antigen Lysate
Supplier Cat # Size Name Details
Sino Biological 40021-V08HL 300 µg Human coronavirus spike glycoprotein (isolate HKU1) (aa 1-760) HEK293 Cell Lysate (WB positive control) HEK293 Cells
Sino Biological 40592-V05HL 300 µg SARS-CoV-2 (2019-nCoV) Spike HEK293 Cell Lysate (WB positive control)

Human Cells

RBD of 2019-nCoV spike was expressed with the Fc region of mouse IgG1 at the C-terminus.

Sino Biological 40591-V08HL 300 µg SARS-CoV-2 (2019-nCoV) Spike HEK293 Cell Lysate (WB positive control)

Human Cells

2019-nCoV spike protein S1 was expressed with a polyhistidine tag at the C-terminus

Sino Biological 40591-V05H1L 300 µg SARS-CoV-2 (2019-nCoV) Spike HEK293 Cell Lysate (WB positive control) 2019-nCoV spike protein S1 was expressed with the Fc region of mouse IgG1 at the C-terminus.
Sino Biological 40591-V02HL 300 µg SARS-CoV-2 (2019-nCoV) Spike HEK293 Cell Lysate (WB positive control)

Human Cells

2019-nCoV spike protein S1 was expressed with the Fc region of human IgG1 at the C-terminus.

Sengenics 39501 Pre-order Recombinant SARS-CoV-2 Nucleocapsid Protein lysates  expressed in baculovirus expression system using the patented KREX™ functional proteomics technology. Proteins are expressed in insect cells (GenBank accession code: MN908947.3, Protein sequence length (a.a): 419)
Sengenics 39502 Pre-order Recombinant SARS-CoV-2 Spike Protein lysates  expressed in baculovirus expression system using the patented KREX™ functional proteomics technology. Proteins are expressed in insect cells (GenBank accession code: YP_009724390.1, Protein sequence length (a.a): 1273)
Sengenics 39503 Pre-order Multiple recombinant Hemagglutinin protein lysates  expressed in baculovirus expression system using the patented KREX™ functional proteomics technology
Sengenics 39504 Pre-order Recombinant SARS and recombinant MERS protein lysates  expressed in baculovirus expression system using the patented KREX™ functional proteomics technology. Proteins are expressed in insect cells (GenBank accession code: (SARS) NP_828858.1, Protein sequence length (a.a): 422); (MERS) GenBank accession code: AKQ21082.1, Protein sequence length (a.a): 413).
Supplier Cat # Size Name Details
BioVision A2060-50 50 µg Anti-SARS-CoV-2 Antibody (Nucleoprotein) (Clone# 6F10) Mouse Monoclonal Immunogen: Synthetic peptide targeting amino acids 300-400 of SARS-CoV-2 nucleoprotein
Application: IHC, WB, ELISA
BioVision A2061-50 50 µg Anti-SARS-CoV-2 Antibody (Nucleoprotein) Rabbit Polyclonal Immunogen: Synthetic peptide targeting amino acids 1-100 of SARS-CoV-2 nucleoprotein
Application: WB, ELISA
Sino Biological 40021-T60 50 μL, 100 μL Human coronavirus spike glycoprotein Antibody, Rabbit PAb, Antigen Affinity Purified

Specificity: HCoV-HKU1 CoV spike

Immunogen: Recombinant Human coronavirus spike glycoprotein protein (Catalog#40021-V08H)

Sino Biological 40021-MM07 50 μL, 100 μL Human coronavirus spike glycoprotein Antibody, Mouse MAb Specificity: HCoV-HKU1 CoV spike
No cross-reactivity in ELISA with
Human cell lysate (293 cell line)
Immunogen: Recombinant Human coronavirus spike glycoprotein protein (Catalog#40021-V08H)
Sino Biological 40021-RP01 100 μL, 200 µL Human coronavirus spike glycoprotein Antibody, Rabbit PAb Specificity HCoV-HKU1 CoV spike
Immunogen: Human coronavirus spike glycoprotein (Catalog#40021-V08H)
Sino Biological 40021-R028 50 μL, 100 μL Human coronavirus spike glycoprotein Antibody, Rabbit MAb Specificity HCoV-HKU1 CoV spike
Immunogen: Recombinant Human coronavirus spike glycoprotein protein (Catalog#40021-V08H)
XpressBio SPC864 0.5 ml Simian COVID-19 Positive Control for ELISA Positive control containing antibodies against COVID-19
XpressBio SNC864 0.5 ml Simian COVID-19 Negative Control for ELISA  
GenScript A02038 100 ug, 1mg SARS-CoV-2 Spike S1 Antibody (HC2001), Human Chimeric The product is specific for SARS-CoV-2 Spike Protein S1 subunit and its RBD domain.
GenScript A01854 200 uL Mouse Anti-Human IgG Fc Antibody[HRP], mAb This product reacts with the Fc portion of human IgG but not with the Fab portion of human IgG. 
Sino Biological 40592-T62 50ul,100ul SARS-CoV-2 (2019-nCoV) Spike RBD Antibody, Rabbit PAb, Antigen Affinity Purified Immunogen:Recombinant SARS-CoV-2 / 2019-nCoV Spike/RBD Protein (Catalog#40592-V05H). Applications:  WB,ELISA,IHC-P,FCM,ICC/IF,IP (Antibody's applications have not been validated with corresponding viruses. Optimal concentrations/dilutions should be determined by the end user.)
Sino Biological 40590-T62 50ul,100ul SARS-CoV-2 (2019-nCoV) Spike S2 Antibody, Rabbit PAb, Antigen Affinity Purified Immunogen:Recombinant SARS-CoV-2 / 2019-nCoV Spike/S2 Protein (Catalog#40590-V08B). Applications: WB,ELISA,IHC-P,FCM,ICC/IF,IP (Antibody's applications have not been validated with corresponding viruses. Optimal concentrations/dilutions should be determined by the end user.)
Sino Biological 40589-T62 50ul,100ul SARS-CoV-2 (2019-nCoV) Spike Antibody, Rabbit PAb, Antigen Affinity Purified Immunogen:Recombinant SARS-CoV-2 / 2019-nCoV Spike Protein (Catalog#40589-V08B1). Applications: WB,ELISA,IHC-P,FCM,ICC/IF,IP (Antibody's applications have not been validated with corresponding viruses. Optimal concentrations/dilutions should be determined by the end user.)
Sino Biological 40150-D001 50ul,100ul SARS-CoV/SARS-CoV-2 Spike antibody,Chimeric MAb Immunogen:Recombinant SARS-CoV Spike RBD Protein (Catalog#40150-V08B2). Has cross-reactivity in ELISA with SARS-CoV-2 (2019-nCoV) Spike S1 Protein (Cat# 40591-V08H). Applications: ELISA,IHC-P,FCM,ICC/IF,IP (Antibody's applications have not been validated with corresponding viruses. Optimal concentrations/dilutions should be determined by the end user.)
Sino Biological 40150-D004 50ul,100ul SARS-CoV/SARS-CoV-2 Spike antibody,Chimeric MAb Immunogen: Recombinant SARS-CoV Spike RBD Protein (Catalog#40150-V08B2).Has cross-reactivity in ELISA with SARS-CoV-2 (2019-nCoV) Spike S1 Protein (Cat# 40591-V08H). Applications: ELISA,IHC-P,FCM,ICC/IF,IP (Antibody's applications have not been validated with corresponding viruses. Optimal concentrations/dilutions should be determined by the end user.)
Sino Biological 40150-D006 50ul,100ul SARS-CoV/SARS-CoV-2 Spike Antibody,Chimeric MAb Immunogen: Recombinant SARS-CoV Spike RBD Protein (Catalog#40150-V08B2). Has cross-reactivity in ELISA with SARS-CoV-2 (2019-nCoV) Spike S1 Protein (Cat# 40591-V08H).Applications: ELISA,IHC-P,FCM,ICC/IF,IP (Antibody's applications have not been validated with corresponding viruses. Optimal concentrations/dilutions should be determined by the end user.)
Sino Biological 40150-D002 50ul,100ul SARS-CoV/SARS-CoV-2 Spike antibody,Chimeric MAb Immunogen: Recombinant SARS-CoV Spike RBD Protein (Catalog#40150-V08B2). Has cross-reactivity in ELISA with SARS-CoV-2 (2019-nCoV) Spike S1 Protein (Cat# 40591-V08H). Applications: ELISA,IHC-P,FCM,ICC/IF,IP (Antibody's applications have not been validated with corresponding viruses. Optimal concentrations/dilutions should be determined by the end user.)
Sino Biological 40150-D003 50ul,100ul SARS-CoV/SARS-CoV-2 Spike antibody,Chimeric MAb Immunogen: Recombinant SARS-CoV Spike RBD Protein (Catalog#40150-V08B2). Has cross-reactivity in ELISA with SARS-CoV-2 (2019-nCoV) Spike S1 Protein (Cat# 40591-V08H). Applications: Has cross-reactivity in ELISA with SARS-CoV-2 (2019-nCoV) Spike S1 Protein (Cat# 40591-V08H).
Sino Biological 40150-D005 50ul,100ul SARS-CoV/SARS-CoV-2 Spike antibody,Chimeric MAb Immunogen: Recombinant SARS-CoV Spike RBD Protein (Catalog#40150-V08B2). Has cross-reactivity in ELISA with SARS-CoV-2 (2019-nCoV) Spike S1 Protein (Cat# 40591-V08H). Applications: ELISA,IHC-P,FCM,ICC/IF,IP (Antibody's applications have not been validated with corresponding viruses. Optimal concentrations/dilutions should be determined by the end user.)
Sino Biological 40150-R007 50ul,100ul SARS-CoV-2 (2019-nCoV) Spike S1 Antibody, Rabbit MAb Has cross-reactivity in ELISA with SARS Coronavirus Spike Protein (S1 Subunit) (Cat# 40150-V08B1), SARS Coronavirus Spike RBD (Cat# 40150-V08B2).Applications: ELISA,IHC-P,FCM,ICC/IF,IP (Antibody's applications have not been validated with corresponding viruses. Optimal concentrations/dilutions should be determined by the end user.)
Sino Biological 40588-T62 50ul,100ul SARS-CoV-2 (2019-nCoV) Nucleocapsid Antibody, Rabbit PAb, Antigen Affinity Purified Immunogen: Recombinant SARS-CoV-2 / 2019-nCoV Nucleocapsid Protein (Catalog#40588-V08B). Application: WB,ELISA,IHC-P,FCM,ICC/IF,IP (Antibody's applications have not been validated with corresponding viruses. Optimal concentrations/dilutions should be determined by the end user.)
Supplier Cat # Size Name Details
MBLI tb-XXXX-XX 25 ug QuickSwitch™ Custom Tetramer Kits
HLA-A*02:01, HLA-A*11:01, HLA-A*11:01, HLA-A*24:02 or H-2Kb
Screening for COVID-19 T-cell peptides and immune monitoring with MHC tetramers in a single assay. By using MBLI’s peptide screening MHC tetramer exchange QuickSwitch™ platform, you can identify/validate the binding of predicted peptide sequences of the COVID-19 viral proteins in most common alleles: H2Kb, A2, A11, A24, A3 and DR1, DR4, DR15.

PE, APC, BV241
ProImmune Custom Req. Avail.   COVID-19 (N Protein & S Protein) Pentamer or Tetramer available
HLA Allele: A*02:01, B*40:01, DRB1*01:01, DRB1*03:01, *04:01, *13:01, *15:01
SARS-CoV-derived T cell epitopes obtained using positive T cell assays that are identical in SARS CoV-2
Viruses 2020, 12, 254:
Supplier Cat # Size Name Details
Biotium 31000 5 x 1 mL EvaGreen® Dye, 20X in Water

LAMP PCR COVID-19 with EvaGreen. A Single and Two-Stage, Closed-Tube, Molecular Test for the 2019 Novel
Coronavirus (COVID-19) at Home, Clinic, and Points of Entry. (Published:

Biotium 31077 5 x 1 mL EvaGreen® Plus Dye, 20X in Water EvaGreen® Plus Dye has an improved signal-to-noise compared to original EvaGreen® dye, for higher sensitivity in DNA amplification applications
Sino Biological VG40588-UT 1 unit SARS-CoV-2 (2019-nCoV) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) Expression Vector (No Tag)
Sino Biological VG40589-UT 1 unit SARS-CoV-2 (2019-nCoV) Spike ORF mammalian expression plasmid (Codon Optimized) Expression Vector (No Tag)
Sino Biological VG40592-UT 1 unit SARS-CoV-2 (2019-nCoV) Spike(RBD) ORF mammalian expression plasmid (Codon Optimized) Expression Vector (No Tag)
Sino Biological VG40590-UT 1 unit SARS-CoV-2 (2019-nCoV) Spike(S2) ORF mammalian expression plasmid (Codon Optimized) Expression Vector (No Tag)
Sino Biological VG40591-UT 1 unit SARS-CoV-2 (2019-nCoV) Spike(S1) ORF mammalian expression plasmid (Codon Optimized) Expression Vector (No Tag)
Sino Biological VG40596-UT 1 unit SARS-CoV-2 (2019-nCoV) Helicase/HE Gene ORF cDNA clone expression plasmid Expression Vector (No Tag)
Sino Biological VG40598-UT 1 unit SARS-CoV-2 (2019-nCoV) Methyltransferase/ME Gene ORF cDNA clone expression plasmid Expression Vector (No Tag)
Sino Biological VG40599-UT 1 unit SARS-CoV-2 (2019-nCoV) NSP10 Gene ORF cDNA clone expression plasmid Expression Vector (No Tag)
Sino Biological VG40594-UT 1 unit SARS-CoV-2 (2019-nCoV) 3C-like proteinase/3CLpro Gene ORF cDNA clone expression plasmid Expression Vector (No Tag)
Sino Biological VG40593-UT 1 unit SARS-CoV-2 (2019-nCoV) Papain-like proteinase/NSP3 Gene ORF cDNA clone expression plasmid(Partly) Expression Vector (No Tag)
Sino Biological VG40597-UT 1 unit SARS-CoV-2 (2019-nCoV) EndoRNAse/EN Gene ORF cDNA clone expression plasmid Expression Vector (No Tag)
Sino Biological VG40605-CF 1 unit Human coronavirus(HCoV-229E) Spike Gene ORF cDNA clone expression plasmid Expression Vector (C-Flag tag)
Sino Biological VG40021-G-N 1 unit Human Coronavirus spike glycoprotein partial ORF mammalian expression plasmid (Codon Optimized) Expression Vector (No Tag)
Sino Biological VG40021-NF 1 unit Human Coronavirus (HCoV-HKU1) spike glycoprotein partial ORF mammalian expression plasmid (Codon Optimized) Expression Vector (N-Flag tag)
Sino Biological VG40021-ACGLN 1 unit Human Coronavirus (HCoV-HKU1) spike glycoprotein partial Gene Lentiviral ORF cDNA expression plasmid (Codon Optimized) Lentiviral (C-GFP Spark tag)
Sino Biological VG40604-CF 1 unit Human coronavirus (HCoV-NL63) Spike Gene ORF cDNA clone expression plasmid, Expression Vector (C-Flag tag)
Sino Biological VG40607-CF 1 unit Human coronavirus (HCoV-OC43) Spike Gene ORF cDNA clone expression plasmid Expression Vector (C-Flag tag)
GenScript MC_0101076   pUC57-2019-nCoV-PC:RdRP This plasmid contains part of 2019-nCoV(SARS-CoV-2) RdRP gene and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR
GenScript MC_0101077   pUC57-2019-nCoV-PC:N This plasmid contains part of 2019-nCoV(SARS-CoV-2) N gene and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR
GenScript MC_0101078   pUC57-2019-nCoV-PC:E This plasmid contains part of 2019-nCoV(SARS-CoV-2) E gene and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR
GenScript MC_0101079   pUC57-2019-nCoV-PC:ORF1ab This plasmid contains part of 2019-nCoV(SARS-CoV-2) ORF1ab and can be used as positive control for the detection of 2019-nCoV(SARS-CoV-2) by qRT-PCR
GenScript MC_0101080   pUC57-2019-nCoV-S(Original) This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (original sequence)
GenScript MC_0101081   pUC57-2019-nCoV-S(Human) This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (Codon optimized for Human expression system)
GenScript MC_0101082   pUC57-2019-nCoV-S(E. coli) This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (Codon optimized for E. Coli expression system)
GenScript MC_0101083   pUC57-2019-nCoV-S(CHO) This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (Codon optimized for CHO expression system)
GenScript MC_0101084   pUC57-2019-nCoV-S(Insect) This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) surface glycoprotein (Codon optimized for Insect expression system)
GenScript MC_0101085   pUC57-2019-nCoV-N This plasmid contains the encoding gene of 2019-nCoV(SARS-CoV-2) nucleocapsid phosphoprotein (original sequence)
GenScript MC_0101086   pcDNA3.1+/C-(K)DYK-ACE2 (NM_021804.2, OHu20260) Homo sapiens angiotensin I converting enzyme 2 (ACE2), the receptor for 2019-nCoV(SARS-CoV-2).
GenScript MC_0101087 2019-nCov_pcDNA3.1(+)-P2A-eGFP The plasmid is used for 2019-nCoV surface glycoprotein expression (Codon Optimized for Mouse expression system). The surface glycoprotein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.
GenScript MC_0101088 SARS_pcDNA3.1(+)-P2A-eGFP The plasmid is used for 2019-nCoV surface glycoprotein expression (Codon Optimized for Mouse expression system). The surface glycoprotein is integrated with eGFP protein through P2A, which can be used for flow cytometry antibody screening or immunological research.
GenScript MC_0101089 2019-nCov-Linker_pcDNA3.1(+)-C-eGFP The plasmid is used for 2019-nCoV surface glycoprotein expression (Codon Optimized for Mouse expression system). The surface glycoprotein is integrated with eGFP protein through linker, which can be used for flow cytometry antibody screening.
GenScript MC_0101090 SARS-Linker_pcDNA3.1(+)-C-eGFP The plasmid is used for SARS surface glycoprotein expression (Codon Optimized for Mouse expression system). The surface glycoprotein is integrated with eGFP protein through linker, which can be used for flow cytometry antibody screening.
Coronavirus Nucleic Acid Detection Kit (RT-PCR)
Supplier Cat # Size Name Details
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol Gene/Oligo name oligo Sequence(5'-3')
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol RdRP_SARSr-P2 (5'FAM, 3'BHQ-1) CAGGTGGAACCTCATCAGGAGATGC
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol RdRP_SARSr-P1 (5'FAM, 3'BHQ-1) CCAGGTGGWACRTCATCMGGTGATGC
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol E_Sarbeco_P1 (5'FAM, 3'BHQ-1) ACACTAGCCATCCTTACTGCGCTTCG
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol N gene-F GGGGAACTTCTCCTGCTAGAAT
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol N gene-R CAGACATTTTGCTCTCAAGCTG
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol N gene-P (5'FAM, 3'TAMRA) TTGCTGCTGCTTGACAGATT
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol ORF1ab-F CCCTGTGGGTTTTACACTTAA
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol ORF1ab-R ACGATTGTGCATCAGCTGA
GenScript SC1516 5nmol, 10nmol, 50nmol, 100nmol ORF1ab-P (5'FAM, 3'BHQ-1) CCGTCTGCGGTATGTGGAAAGGTTATGG
GenScript SC1618 100 Rxns 1 step 1 plex qPCR detection assay kit ORF1ab gene, RdRP gene, N gene or E gene
GenScript SC1618 100 Rxns 1 step 2 plex qPCR detection assay kit ORF1ab+N genes or RdRP+E genes
RayBiotech PCR-COV 20 tests Coronavirus Nucleic Acid Detection Kit (RT-PCR) 20 tests. Suitable for the qualitative detection of new coronavirus ORF1ab and nucleocapsid protein N gene in human throat swabs and alveolar lavage.
BioVision K1460-100 100 Rxns Coronavirus (SARS-CoV-2) RT-PCR Detection Kit An ideal tool to detect SARS-CoV-2 by RT-PCR method
• 2X qPCR Master Mix
• Reverse Transcription Mix
• PCR Primer/ Probe set
• Rehydration Buffer
• COVID-19 Positive control (PTC)
• Non-Template Negative Control (NTC)
USBiological 532222, 532223, 532224 1 kit genesig® Coronavirus (COVID-19) Real-Time PCR Detection Kit
Easy (532222), Standard (532223) and Advanced (532224) kits available
NEW! Coronavirus (COVID-19) CE-IVD kit which exclusively detects only this outbreak strain.

Product features

Rapid detection and exclusive to the COVID-19 strain
Does not detect other related coronavirus strains
High priming efficiency
Accurate controls to confirm extraction, and assay validity
Lyophilised components for ambient shipping
Highly specific detection profile
The genesig Real-Time PCR COVID-19 (CE) is CE-IVD marked and intended for in vitro diagnostic use in Europe.
Array Kits
Supplier Cat # Size Name Details
RayBiotech QAH-INF-1-1 8, 22, 50
Human Inflammation Array Q1 IL-1 alpha, IL-1 beta, IL-4, IL-6, IL-8, IL-10, IL-13, MCP-1, IFN-gamma, TNF alpha
RayBiotech QAH-INF-3-1 8, 22, 50
Human Inflammation Array Q3 BLC, Eotaxin-1, Eotaxin-2, G-CSF, GM-CSF, I-309, ICAM-1, IFN-gamma, IL-1 alpha, IL-1 beta, IL-1 ra, IL-2, IL-4, IL-5, IL-6, IL-6 sR, IL-7, IL-8, IL-10, IL-11, IL-12 p40, IL-12 p70, IL-13, IL-15, IL-16, IL-17, MCP-1, M-CSF, MIG, MIP-1 alpha, MIP-1 beta, MIP-1 delta, PDGF-BB, RANTES, TIMP-1, TIMP-2, TNF alpha, TNF beta, sTNFRI, sTNFRII
RayBiotech QAH-TH-1-1 8, 22, 50
Human Th1/Th2 Array Q1 GM-CSF, IFN-gamma, IL-10, IL-13, IL-2, IL-4, IL-5, IL-6, IL-8 (CXCL8), TNF alpha
Sengenics 39505 Pre-order COVID-19 microarray  Contains full-length, correctly folded and functional human SARS-CoV-2 and antigens from other respiratory viruses including influenza, SARS
and MERS
Sengenics 39506 Pre-order COVID-19 diagnostic/surveillance test
High-throughput, high multiplex microtitre plate
Contains full-length, correctly folded and functional human SARS-CoV-2 and antigens from other respiratory viruses including influenza, SARS
and MERS
Sino Biological on request Pre-order Coronavirus Antigen Array (HCoV-OC43, HCoV-229E, SARS-CoV, HCoV-NL63, HCoV-HKU1, MERS-CoV, SARS-CoV-2, Influeza virus, RSV, Rhinovirus, Metapneumovirus, Parainfluenza, Adenovirus)   Sino Biological and Nanommune (Irvine, California) jointly developed the coronavirus antigen array. These arrays are constructed by printing recombinant antigens on a nitrocellulose-coated membrane. It can analyze serum antibodies against 65 antigens from 23 types of viruses known to cause respiratory tract infections, including SARS-COV-2 and the other six coronaviruses. The array is specifically designed for high throughput serological surveillance studies. 
ProcartaPlex EPX180-12172-901 96 tests Th1/Th2 Cytokine 18-Plex Human ProcartaPlex™ Panel 1C GM-CSF; IFN gamma; IL-1 beta; IL-2; IL-4; IL-5; IL-6; IL-12 p70; IL-13; IL-18; TNF alpha; IFN alpha; IL-1 alpha; IL-1RA; IL-7; IL-15; IL-31; TNF beta
ProcartaPlex EPX200-12185-901 96 tests Inflammation 20-Plex Human ProcartaPlex™ Panel sE-Selectin; GM-CSF; ICAM-1/CD54; IFN alpha; IFN gamma; IL-1 alpha; IL-1 beta; IL-4; IL-6; IL-8; IL-10; IL-12p70; IL-13; IL-17A/CTLA-8 ; IP-10/CXCL10; MCP-1/CCL2; MIP-1alpha/CCL3; MIP-1 beta/CCL4; sP-Selectin; TNF alpha
Test Kits 
Supplier Cat # Size Name Details





20 tests

Coronavirus (SARS-CoV-2) IgM Test Kit (Colloidal Gold)


Coronavirus (SARS-CoV-2) IgM Finger Prick Test Kit (Colloidal Gold)


Coronavirus IgG Test Kit (Colloidal Gold)


Coronavirus (SARS-CoV-2) IgG Finger PrickTest Kit (Colloidal Gold)

20 strips. Suitable for the qualitative detection of coronavirus N-Protein IgM / IgG antibodies in human serum, plasma, or peripheral blood. RayBiotech offers new tools for fighting against Coronavirus for in vitro diagnostic use, following guidance from the FDA for Emergency Use Authorizations of tests submitted for approval on March 16, 2020. These tests have not been reviewed by the FDA and results from antibody testing should not be used as the sole basis to diagnose or exclude SARS-CoV-2 infection or to inform infection status.


1, 2 or 5 plate

COVID-19 / SARS-CoV-2 Nucleocapsid Protein ELISA Kit.

Sandwich-based. Detects the N-Protein (standard protein code: 230-01104).
Abnova DC0301 20 tests COVID-19 Human IgM/IgG Rapid Test COVID-19 Human IgM/IgG Rapid Test provides a fast, convenient, and qualitative testing of human whole blood, plasma, and serum for COVID-19 IgM and IgG. This product is a lateral flow immunoassay for the rapid detection of human IgM and IgG antibodies against COVID-19 virus in human whole blood, plasma, or serum. This product is for professional use only.
US Biological 532400 25 tests 2019-nCoV IgG/IgM RapiCard™ InstaTest|(Whole Blood/Serum/Plasma) |(Not For Use in USA, For Export Use Only)

This 2019-nCoV IgG/IgM Rapid Test Cassette is a lateral flow chromatographic immunoassay for the qualitative detection of IgG and IgM antibodies to 2019-nCoV in human whole blood, serum or plasma specimen. The 2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma) was compared with a leading commercial PCR; the results show that 2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma) has a high sensitivity and specificity.

Relative Sensitivity: 85.0% (95%CI*: 62.1%-96.8%) *Confidence Interval|Relative Specificity: 96.0% (95%CI*: 86.3%-99.5%) Accuracy: 92.9% (95%CI*: 84.1%-97.6%)

Detection Method:Qualitative

Sample Matrix: Whole blood, serum or plasma

Sengenics Pre-order 1 kit Lateral Flow Device 3 Covid-19 antigens (Spike nucleocapsid protein and two types of surface glycoproteins).  World's 1st antigen-based diagnostic test  based on these three antigens. Ready within 6-8 weeks. 
GenScript L00831 1 Kit SARS-CoV-2 Spike S1-RBD IgG&IgM ELISA Detection Kit Indirect ELISA detection tool which can be used for evaluation of anti-SARS-CoV-2 Spike S1-RBD IgG or IgM in samples
GenScript L00830 1 kit SARS-CoV-2 Spike S1-RBD IgG ELISA Detection Kit Indirect ELISA detection tool which can be used for evaluation of anti-SARS-CoV-2 Spike S1-RBD IgG in samples.
Abnova KA5826 1 kit COVID-19 Human IgM IgG Assay Kit  Indirect ELISA for qualitative determination of COVID-19 human serum IgM and IgG.
Sino Biological KIT40588 1 Kit SARS-CoV-2 (2019-nCoV) Nucleoprotein / NP ELISA Kit Solid Phase Sandwich ELISA (quantitative)
Sino Biological MB40021-MM07 20T, 100T Anti-Human coronavirus spike glycoprotein Magnetic Beads Immunoprecipitation (IP) Kit Monoclonal HCoV-HKU1 Mouse IgG1
Sino Biological MB40021-T60 20T, 100T Anti-Human coronavirus spike glycoprotein Magnetic Beads Immunoprecipitation (IP) Kit Polyclonal HCoV-HKU1 Rabbit IgG
Sino Biological MB40021-R028 20T, 100T Anti-Human coronavirus spike glycoprotein Magnetic Beads Immunoprecipitation (IP) Kit Monoclonal HCoV-HKU1 Rabbit IgG
XpressBio SP864C 1 Kit COVID-19 ELISA Plate 48 Antigen Wells, 48 Control Antigen Wells. Each plate is coated with a mixture of recombinant SARS-CoV-2 Spike gylcoprotein (S1) and SARS-CoV-2 Spike glycoprotein (S2) produced in HEK293 cells, sequence strain Wuhan-Hu-1.
BPS Bioscience 79931 96 reactions SARS-CoV-2 Spike:ACE2 Inhibitor Screening Assay Kit This kit is useful for screening inhibitors of SARS-CoV-2 Spike binding to ACE2.
BPS Bioscience 79936 96 reactions ACE2:SARS-CoV-2 Spike Inhibitor Screening Assay Kit This kit is useful for screening for inhibitors of ACE2 binding to SARS-CoV-2 Spike.
BPS Bioscience 79923 96 reactions ACE2 Inhibitor Screening Assay Kit Useful for studying enzyme kinetics and screening small molecule inhibitors and antibodies for drug discovery and HTS applications.
Small molecules
Supplier Cat # Size Name Details
Biorbyt orb636857 10 mg, 25 mg, 100 mg  GS-5734 (Remdesivir) C28H36N5O8P
Active Biochem A-1340 5 mg, 10mg, 50 mg, 100 mg GS-5734 (Remdesivir) C28H36N5O8P
BioVision B2997 500 µg, 1 mg Remdesivir Anti-Viral Reagent C28H36N5O8P
Other related reagents
APExBIO: Solutions for Coronavirus research